                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:136 nt.     Distance to run of Ts=1 nt.   Size=27 nt.     Delta G=-10.10 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -6.30 kcal/mol
Anti-antiterminator:   Size=76 nt.     Delta G=-25.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCAAGCGCGTAGTTGGAGTTGTCGTTGGGACCCGCCGTCAATGCCGCACCATTTCTG
TGAACCAAtcgtgtattggttcatttgcggagaaattcgggtgcaggtcaagcgtatttttgaaccataatttttggtgctcaaaacatgggca
cgaagcatttttcaaaggctgcgcgcggctttcatctgcacgttctagaacagggaacccgacaacaaacgttccctccgcaacacgctgcaacacttgg
cgaaaccatgcgttatagtctcgcagatcatgagatgccgggggcgatATG

    AGR_L_329 Gene: AGR_L_329     GI: 15890276     BI number: AGR_L_329     GOG: COG2202,COG2771     Description: AGR_L_329   t g  g c  t ta At At Cg Cg At At Gc |  a |  t |  t |  t Tg Gc Tg        ta Cg       g  t Ta       c  t Tg        gt Ta        at |  a       at |  a       cg |  t      |  a |  t       ta |  c       gc A  g       gc Cg       |  a Cg       |  t At       |  a        a Cg       |  a      a  c Gc       |  t      a  a |  a      |  t       at Cg       |  t       cg Cg       |  t       tg Gt       |  t       cg T  c      a  g       gc A  a       cg        ta A  a       gt        gc C  |       tg       g  g Tg        gc        ta Gc        gt        ta Cg        gc        tg                         catttttcaaaggctgcgcgcggctttcatctgcacgttctagaacagggaacccgacaacaaacgttccctccgcaacacgctgcaacacttggcgaaaccatgcgttatagtctcgcagatcatgagatgccgggggcgatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG2202 FOG: PAS/PAC domain ... can be seen here [K] COG2771 DNA-binding HTH domain-containing proteins ... can be seen here     ..................................................................................................................