                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:84 nt.     Distance to run of Ts=2 nt.   Size=18 nt.     Delta G= -6.60 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -6.40 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G=-10.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCCTTGTCAGTTTGACCGCACCTGCACCGGCGGCGGCACCGACAGCAAGGATGGCAA
CGGCCGCGAACGTCATGGCCGCGGTTTTGCGACGGTGTTTCCGGTGTGGCGGCACCGG
CGCTTCCGTCGCAGCTTTCGGCGCGGGGGAAGATTCGATTTCTTTATTGTCTTCAGAG
TGGGACATgttgatctcctgtttgaatggacaggcatgttttaaccgcagccggccaccagcagcctgaaccttgtggttcagcttgagttaag
ccttccgggcctaataaaacgcatccaacaccATG

    AGR_L_339 Gene: AGR_L_339     GI: 15890281     BI number: AGR_L_339     GOG: COG0745     Description: AGR_L_339 CT T  T T  T TA AT GT CG T  | T  | AT GC AT AT GC G  A G  G G  A       tt G  |      g  g C  |       Ta G  |       At CG       C  c GT        At G  G       Gc CG        Gc TG        Gt        aa TA        Tg       g  t |  C      G  |       tg |  A       At        tg T  T       Gt        ta Cg        At        gc Gt        Cg        ta At        Ta        cg Cg        Ta        cg                         catgttttaaccgcagccggccaccagcagcctgaaccttgtggttcagcttgagttaagccttccgggcctaataaaacgcatccaacaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [TK] COG0745 Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain ... can be seen here     ..................................................................................................................