                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:135 nt.     Distance to run of Ts=2 nt.   Size=29 nt.     Delta G=-21.10 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -8.20 kcal/mol
Anti-antiterminator:   Size=20 nt.     Delta G= -4.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGTGCCGCTGCACCAGCAGCCGATTGCCTGGGCGATGCTCGCCAAGGTCAAGAGCGT
CGACTTCCGCGCCGACAATAAGCCGCGCCATTGGCTGACCCAGCTCGATAAATAAgacg
gattgcaagtgaggcgccggtcattcgaccgagcgccttggttgttttcagcaggcatccgtctggcagcgcgatgatctgcgtcagaaattgtcgacaa
agttgcaacggtttcgtggttcttgcatggcgcgtaacccatggcccgtctctggaagagaatgatcgaacctgcatgcccgcGTG

    AGR_L_368 --- AGR_L_366 --- AGR_L_364 --- AGR_L_363 --- AGR_L_360 --- AGR_L_359 Gene: AGR_L_368     GI: 15890297     BI number: AGR_L_368     GOG: COG0601     Description: AGR_L_368p Gene: AGR_L_366     GI: 15890296     BI number: AGR_L_366     GOG: COG1173     Description: AGR_L_366p Gene: AGR_L_364     GI: 15890295     BI number: AGR_L_364     GOG: COG0402     Description: AGR_L_364p Gene: AGR_L_363     GI: 15890294     BI number: AGR_L_363     GOG: COG0402     Description: AGR_L_363p Gene: AGR_L_360     GI: 15890293     BI number: AGR_L_360     GOG: COG0444     Description: AGR_L_360p Gene: AGR_L_359     GI: 15890292     BI number: AGR_L_359     GOG: COG4608     Description: AGR_L_359            cg           a  g           g  a            At            At            Tg           A  c           A  a           A  a           T  g           A  |       tt            Gt       a  c            Cg        cg            Ta        ta   C       |  g       gc A  C       Cg        gc GC        Gc        cg TA       |  g      |  a CG       A  c       cg GC       C  c       gc |  T       Cg        cg GC        Cg        gc TG        At        gc TA        Gc        at AT        Ta        gt                         ggttgttttcagcaggcatccgtctggcagcgcgatgatctgcgtcagaaattgtcgacaaagttgcaacggtttcgtggttcttgcatggcgcgtaacccatggcccgtctctggaagagaatgatcgaacctgcatgcccgcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EP] COG0601 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here [EP] COG1173 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here [FR] COG0402 Cytosine deaminase and related metal-dependent hydrolases ... can be seen here [FR] COG0402 Cytosine deaminase and related metal-dependent hydrolases ... can be seen here [EP] COG0444 ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component ... can be seen here [E] COG4608 ABC-type oligopeptide transport system, ATPase component ... can be seen here     ..................................................................................................................