Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:152 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G= -6.80 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-10.60 kcal/mol
Anti-antiterminator:   Size=62 nt.     Delta G=-24.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gctcgcacattttgaatacataaagtatacaaaggcgaggctaatgcaatctgtcttttcacgtcgtggcgccagcacgtgcaaatcggcgtcagccgga
aagggtggatatatctataggccgcgacaccgtgcttacgcggttttttccattcaggccgctcaaccaatctcattcgttcgcacacgcaaaaaattct
ttttgtatactcattgtatttttatattgatttatcgctgccatggggaaatagtgatcgcgccttcaacggcagaccaattgatgggagcaaatcaaca
ATG

    AGR_L_407


Gene: AGR_L_407     GI: 15890315     BI number: AGR_L_407     GOG: COG0834     Description: AGR_L_407


 cg
a  t
 cg
 gc
|  a
|  a
|  a
|  t
a  c
 cg
 cg
 gc        tc
 cg       a  t
 gt        ta
 gc        at
 ta        ta
g  g      |  g
c  c      a  g
t  |       gc
 gc        gc
 cg        tg
a  |       gc
 cg       g  g
 ta       g  a
 ta       a  c
 ta       a  a
 tg       a  |       tt
 cg        gc       c  a
 tg        gc        gc
g  t       cg        tg
t  g      |  t       gc
 cg        cg        cg
 ta        gc        cg
 at        at        at
                        tttttccattcaggccgctcaaccaatctcattcgttcgcacacgcaaaaaattctttttgtatactcattgtatttttatattgatttatcgctgccatggggaaatagtgatcgcgccttcaacggcagaccaattgatgggagcaaatcaacaATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[ET] COG0834 ABC-type amino acid transport/signal transduction systems, periplasmic component/domain ... can be seen here

    ..................................................................................................................