                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:99 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G= -6.90 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -5.00 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-16.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aaatgcaggcgatatcgccacttataaatacttcaacgcccgcttcgcgggcgtttttgtttttggagccctttgttccatggctctcctgcttggcgat
gcggttcattacgcgcgcggtttgtcctgccacaggcaaagggcttggcgcctctcgcgatcaggatcacgcaatcttcggcgaatagcgcgccgtattt
ttggagtgcgaaaattgccatgcatatagcgcatatctgtgctgcaaccttgtgcctgtgaaatgcgcagaaaaatgctatcttccaatcatcgaaacgg
ATG

    AGR_L_417gl Gene: AGR_L_417gl     GI: 15890320     BI number: AGR_L_417gl     GOG: -------     Description: AGR_L_417gl   c a  a cg cg gc |  a |  a ta cg cg tg gc        cg t  t      a  c t  t      c  a t  g       ta g  g       at gc        gc cg        gt gc        at         a |  c      c  c      t  g |  t      t  g      a  c |  c      a  |      a  g c  t      g  |       gc gc        cg        cg cg        gc        gc gc        cg        gc cg        ta        cg                         tatttttggagtgcgaaaattgccatgcatatagcgcatatctgtgctgcaaccttgtgcctgtgaaatgcgcagaaaaatgctatcttccaatcatcgaaacggATG     ..................................................................................................................