                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:214 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-16.70 kcal/mol
Antiterminator: Size=29 nt.     Delta G=-24.00 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G= -9.22 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGGTGTAAggctcgatagtcacggcaagtacgaggccgcgggttcagcctgcggccttgatgccacaggggcccgggcatttttttgccttcg
ccatgccgaacttgtgtcgacgtaatgtggttcacttgacgtgtgtcaaagcctcgaggcccttcctcacctaaacagcccccagcaacctgtcttctcc
cttcaacagtggaaatatcaggtatgaattatgaacgtaaaggtggctggcttcttcggtttcatcgtattacggttgaaactacaggggcgcaggggga
agacggATG

    AGR_L_433 --- AGR_L_430 --- AGR_L_429 Gene: AGR_L_433     GI: 15890324     BI number: AGR_L_433     GOG: COG0845     Description: AGR_L_433p Gene: AGR_L_430     GI: 15890323     BI number: AGR_L_430     GOG: COG0842,COG1131     Description: AGR_L_430p Gene: AGR_L_429     GI: 15890322     BI number: AGR_L_429     GOG: COG0842     Description: AGR_L_429   a a  g g  a g  c g  g g  g g  A aT cG gc                   c cg                 g  c |  a        c       t  a g  g      t  a      a  c g  g      t  g      g  a gc        gc        tg gc        gc        tg a  g       gt        cg c  c       cg        cg a  g       gc        gc tg        cg        gc cg        cg       c  | a  |       gc        gc at        gc        tg at        at        cg gc        gt        cg ta        cg        gc                         atttttttgccttcgccatgccgaacttgtgtcgacgtaatgtggttcacttgacgtgtgtcaaagcctcgaggcccttcctcacctaaacagcccccagcaacctgtcttctcccttcaacagtggaaatatcaggtatgaattatgaacgtaaaggtggctggcttcttcggtttcatcgtattacggttgaaactacaggggcgcagggggaagacggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0845 Membrane-fusion protein ... can be seen here [V] COG0842 ABC-type multidrug transport system, permease component ... can be seen here [V] COG1131 ABC-type multidrug transport system, ATPase component ... can be seen here [V] COG0842 ABC-type multidrug transport system, permease component ... can be seen here     ..................................................................................................................