                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:124 nt.     Distance to run of Ts=3 nt.   Size=24 nt.     Delta G= -8.80 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-13.35 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-20.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTCCGCTGGTCCGGGAGGTAACGAGGAGGATTTCGATAGTCCCGCCATCGGCATAACG
GAAGCAGAGCGCGGCATATTGCTGCCGGAAAGCGCCGGTGAAGAGCTTTTCCGGAACA
GCAGCCAGCTGCTGAAGCAATGTGAGTGGACGGGCCGGGCGGGTCTTCCGGCGTTTCT
TGGCGGGTTTCATATCCGTTGATAGTGCCGATTTTCCGGGTTGCATCAATGCCCCGCG
TGCATTTATGACAGTTTTATGACAATCACCCCCCACAACTAATAAAGCGCCATTGAGG
GCCAAttcgcATG

    AGR_L_497 --- AGR_L_500 Gene: AGR_L_497     GI: 15890356     BI number: AGR_L_497     GOG: COG1392     Description: AGR_L_497p Gene: AGR_L_500     GI: 15890357     BI number: AGR_L_500     GOG: COG0306     Description: AGR_L_500            CA           C  G            GC   T        AT G  G       CG G  A       GC C  A       AT C  G       CG G  A      |  A CG       |  A GC       |  G |  T      |  C AT       |  A AT       |  A AT       |  T GC       |  G GC       |  T CG       |  G CG       |  A |  A      |  G |  A      |  T        G GC       |  G      G  C TA       |  G      G  G CG       |  A       CG GC       |  C       CG TA       |  G       GT T  |      A  G       GC A  |      A  G       GT T  |       GC       C  | A  |       GC        AT CG        CG        GC GC        CG        GC GC        TG        TG                         GCGTTTCTTGGCGGGTTTCATATCCGTTGATAGTGCCGATTTTCCGGGTTGCATCAATGCCCCGCGTGCATTTATGACAGTTTTATGACAATCACCCCCCACAACTAATAAAGCGCCATTGAGGGCCAAttcgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1392 Phosphate transport regulator (distant homolog of PhoU) ... can be seen here [P] COG0306 Phosphate/sulphate permeases ... can be seen here     ..................................................................................................................