                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:102 nt.     Distance to run of Ts=1 nt.   Size=24 nt.     Delta G=-13.60 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-11.50 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G=-16.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

attggaagccatggcctccgatccagtaccggttctggcggaagacgacgtgccggcgatcgagcgcattctcgccggtggcggacgcggtgaagcttcc
ttacgtcacgctggtgaggggcgacggtcatgaatcgccgggcgagctggaaagggcatctgtcgtttgccgatttcaactgtgaaatcggcctttattc
cgcgcttacttcggcggagaagatttcgtttaatatcgtcaaccgcaagaccggtcaccgcgtcgagcggcaatatgtcgacagcgataccggcgagccg
GTG

    AGR_L_505 --- AGR_L_502 Gene: AGR_L_505     GI: 15890359     BI number: AGR_L_505     GOG: COG1273     Description: AGR_L_505p Gene: AGR_L_502     GI: 15890358     BI number: AGR_L_502     GOG: COG1793,COG3285     Description: AGR_L_502 ac g  g cg gt gc |  a |  t |  g g  a       aa g  a      g  a at       g  g gc        tg tg        cg gc        gc gc       |  a |  g      |  t tg       |  c cg       |  t gc       |  g cg        at a  a       gc        ct c  |       cg       a  g tg        gt        at gc        gt        cg c  t       gt        ta a  |       cg        ta t  |      c  c       ta t  |       gc        at cg        cg        gc cg        ta        cg ta        at        cg ta        at        gc                         ctttattccgcgcttacttcggcggagaagatttcgtttaatatcgtcaaccgcaagaccggtcaccgcgtcgagcggcaatatgtcgacagcgataccggcgagccgGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1273 Uncharacterized conserved protein ... can be seen here [L] COG1793 ATP-dependent DNA ligase ... can be seen here [L] COG3285 Predicted eukaryotic-type DNA primase ... can be seen here     ..................................................................................................................