                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:42 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-18.30 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -8.40 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G=-12.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGCCAAGGCTTCGCTGGAGCCCGATGCCAAGAAGCGGGGGGAAATCTACACGCAGAT
GCAGGAGATGTTCGTTGCCCAGAAGCCGGCAGTGCTGCCGATGTTCGAGAGATTCGAG
CCTATCGTGCTGAATGCGCGGGTGAAGGACTATGTCGGGCATCCAAGCCAGACGACCC
GCCTGGAAAACGTGACAAAGGAATAAcggccaggcaaatgcttcccatgaatagagagcgggcggttttaccgcccgtttt
tatttcagtctgcttggcggcttgcggtaacctcggctctttggcTTG

    AGR_L_513 Gene: AGR_L_513     GI: 15890363     BI number: AGR_L_513     GOG: -------     Description: AGR_L_513            ca           c  t            cg AG        ta A  G       ta A  A      c  t C  A      g  a A  T      t  g G  A      a  a TA       a  g        t Gc       a  a      t  t Cg        cg       t  a A  g       gc        gc A  |      g  g       gc A  |      a  |       cg A  |       cg        gc Gc        cg        gc Gc        gc        gc Ta       g  g       cg Cg        cg        gt Cg        At        at Gc        At        gt                         ttatttcagtctgcttggcggcttgcggtaacctcggctctttggcTTG     ..................................................................................................................