                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:143 nt.     Distance to run of Ts=1 nt.   Size=25 nt.     Delta G=-11.00 kcal/mol
Antiterminator: Size=56 nt.     Delta G=-23.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACCGGCACGTTGTTATAAAGGTCCGCAAACACTCTGCTTGGAGCTGGCAGAATATATT
CTGGCACCTTGAGTGCCCTAACCGCGATCTCCCACACGATCCCTGCGCCCACGAGGCT
GCCAATCGTGTGGGTCTGGCCTTTGACGGCCCCCAGTATTTTCGAAAACATgtgtcctcccg
aaattgcccagctgttcagcgagcaatttttcattattggaacaatgttccatatggactgatgtttcgtcaagtggtaattcaggtgaaacacgagaat
tggaatgcagcgggaggaatgcATG

    AGR_L_1027GM --- AGR_L_554 Gene: AGR_L_1027GM     GI: 15890390     BI number: AGR_L_1027GM     GOG: COG1116     Description: AGR_L_1027GMp Gene: AGR_L_554     GI: 15890389     BI number: AGR_L_554     GOG: COG1414     Description: AGR_L_554   C A  G C  A CG CG GC |  T CG GC T  C C  A C  | C  | TA AT GC CG AT CG        TG AT       T  A CG       T  C CG        CG CG        CG T  |       GC C  |       GC T  |      T  | AT       C  | GC       T  | C  |       GC GT        GC CG        GC CG        TA             GTATTTTCGAAAACATgtgtcctcccgaaattgcccagctgttcagcgagcaatttttcattattggaacaatgttccatatggactgatgtttcgtcaagtggtaattcaggtgaaacacgagaattggaatgcagcgggaggaatgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1116 ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component ... can be seen here [K] COG1414 Transcriptional regulator ... can be seen here     ..................................................................................................................