                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:148 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-22.30 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -8.46 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G=-16.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAACGGTGAATACCTATGAGGGCACGCATGACGTGCACGCGCTGATCCTCGGCCG
GGCGCAGACGGGCATTCAGGCGTTTTTCTGAggtttcatccgcatcccctacaccaggaaaaggccttcgaagttcg
cttcgaaggcctttgttttcgaactcggatgctgacgttccaagcgcttggcgaggggattgcaagaccggatgatatggccgataggatgccgtttctc
tccggtcctgattgacgaggcgatatctgcggcccgacccgaccggaaaaacaaggggaagatttATG

    AGR_L_205GM Gene: AGR_L_205GM     GI: 15890566     BI number: AGR_L_205GM     GOG: COG2977     Description: AGR_L_205GM   G G  C G  A C  T AT GC |  A A  G CG GC CG GT GT         c GT       c  t C  T      c  a C  T      c  c GC       t  a GT       a  c       tc CG       c  c      t  g TA       g  a       gc Cg        cg        at Cg        cg        at |  t       ta        gc |  t      a  a       cg |  t      c  a       ta |  c       ta        ta Ta        tg        cg At        tg        cg Gc        gc        gc T  c       gc        gc Cg        At        at Gc        Gt        at                         tgttttcgaactcggatgctgacgttccaagcgcttggcgaggggattgcaagaccggatgatatggccgataggatgccgtttctctccggtcctgattgacgaggcgatatctgcggcccgacccgaccggaaaaacaaggggaagatttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [Q] COG2977 Phosphopantetheinyl transferase component of siderophore synthetase ... can be seen here     ..................................................................................................................