                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:87 nt.     Distance to run of Ts=2 nt.   Size=34 nt.     Delta G=-26.90 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -9.04 kcal/mol
Anti-antiterminator:   Size=15 nt.     Delta G= -5.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttacgcgccaagattgccaaaccgcaccgttttggcagcaaaaaatcgaaagccgcttttccaaccgtcggaaatttgctagttggaccggcacaagaat
tgactgatagtgggataaatccgccctatgcctgacgaaggcgacagtaccgacagtagtcgacaccgaacgaggctggctcgcataacgcgacgccagc
ctcgaattttcttgtttttttcaaagcagcggctttcagcctcggatggtcggtccggggctttgcgcgtttgcacccattcccataaaggctcctgaac
ATG

    AGR_L_1024 Gene: AGR_L_1024     GI: 15890628     BI number: AGR_L_1024     GOG: COG0861,COG1253     Description: AGR_L_1024            gt           a  a            cg            at            gc            cg           |  a           |  c           |  a           |  c           |  c        a           |  g      t  a           |  a      a  c           |  a       cg           |  c       gc           |  g       cg           c  a       ta           a  g      |  c            tg        cg            gc        gc   c        at        gc a  g       cg        ta g  a      |  g       cg ta       |  c       gc cg        at        gc cg        gc        at gc        cg        gc tg        gc        cg                         aattttcttgtttttttcaaagcagcggctttcagcctcggatggtcggtccggggctttgcgcgtttgcacccattcccataaaggctcctgaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0861 Membrane protein TerC, possibly involved in tellurium resistance ... can be seen here [R] COG1253 Hemolysins and related proteins containing CBS domains ... can be seen here     ..................................................................................................................