                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:2 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -7.70 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -8.20 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G= -8.39 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATCATCGACCTCATTCTCGATGTTGCGGAGAAAAAGCTGATCACCTGGCGGCCGAATA
ACGGTGAAGAACGACCTGCATAGgattttcacctggtttcaaatcgagcggggcggccagtcggccggcccgcttttttcgtc
ggcgcaggccaaagccccgccacaatccatacaagtttcgcaaaggtcgcagcgttcaatctcccttcgatcagaattgcggctatttcgaaaacggcat
catggacgtaccttaggggctactgaagttgtgggttccgcatcaactcacaatttattGTG

    AGR_L_1204 --- AGR_L_1206 --- AGR_L_1208 --- AGR_L_1210 Gene: AGR_L_1204     GI: 15890723     BI number: AGR_L_1204     GOG: COG4166     Description: AGR_L_1204p Gene: AGR_L_1206     GI: 15890724     BI number: AGR_L_1206     GOG: COG0601     Description: AGR_L_1206p Gene: AGR_L_1208     GI: 15890725     BI number: AGR_L_1208     GOG: COG1173     Description: AGR_L_1208p Gene: AGR_L_1210     GI: 15890726     BI number: AGR_L_1210     GOG: COG4172     Description: AGR_L_1210 tc t  g t  a a  a t  a c  a g  c g  g       gc cg       g  t gc       g  a ta        gc t  t       at a  c       tg a  a       ta g  |      c  a at        cg cg        at tg       t  | a  a       gt gc        cg         c cg        at       g  a |  t      g  g      c  t |  a      g  |      c  c |  c      t  |       ta |  c      a  |       ta |  t       cg        gc t  t       tg        gt ta        at        gc cg       c  t       ta cg        gc        gc cg        gc        ta tg        cg        ta                         tttattGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG4166 ABC-type oligopeptide transport system, periplasmic component ... can be seen here [EP] COG0601 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here [EP] COG1173 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here [R] COG4172 ABC-type uncharacterized transport system, duplicated ATPase component ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:164 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-24.40 kcal/mol Antiterminator: Size=39 nt.     Delta G= -8.10 kcal/mol Anti-antiterminator:   Size=54 nt.     Delta G=-11.40 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ATCATCGACCTCATTCTCGATGTTGCGGAGAAAAAGCTGATCACCTGGCGGCCGAATA ACGGTGAAGAACGACCTGCATAGgattttcacctggtttcaaatcgagcggggcggccagtcggccggcccgcttttttcgtc ggcgcaggccaaagccccgccacaatccatacaagtttcgcaaaggtcgcagcgttcaatctcccttcgatcagaattgcggctatttcgaaaacggcat catggacgtaccttaggggctactgaagttgtgggttccgcatcaactcacaatttattGTG     AGR_L_1204 --- AGR_L_1206 --- AGR_L_1208 --- AGR_L_1210 Gene: AGR_L_1204     GI: 15890723     BI number: AGR_L_1204     GOG: COG4166     Description: AGR_L_1204p Gene: AGR_L_1206     GI: 15890724     BI number: AGR_L_1206     GOG: COG0601     Description: AGR_L_1206p Gene: AGR_L_1208     GI: 15890725     BI number: AGR_L_1208     GOG: COG1173     Description: AGR_L_1208p Gene: AGR_L_1210     GI: 15890726     BI number: AGR_L_1210     GOG: COG4172     Description: AGR_L_1210 CA G  T TA CG Cg A  a G  | C  | A  | At Gt At At        aa Gc       a  t Ta       c  c Gc        tg Gc        ta C  |       tg A  |       gc        gt A  |      g  g      a  c T  |       tg        cg A  |       cg        cg A  |       cg        gc Gt       a  c       gc Cg        cg        cg Cg        tg       g  g Gt       |  c       gc Gt       t  c       gc C  |       ta        gc Gt        tg        cg Gc        at        gc Ta        gc        at                         tttttcgtcggcgcaggccaaagccccgccacaatccatacaagtttcgcaaaggtcgcagcgttcaatctcccttcgatcagaattgcggctatttcgaaaacggcatcatggacgtaccttaggggctactgaagttgtgggttccgcatcaactcacaatttattGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG4166 ABC-type oligopeptide transport system, periplasmic component ... can be seen here [EP] COG0601 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here [EP] COG1173 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here [R] COG4172 ABC-type uncharacterized transport system, duplicated ATPase component ... can be seen here     ..................................................................................................................