                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:10 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-16.10 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-13.02 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-15.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCCGCACTACGATATCGACATGTATCGTGAAGGCCATACCGTCACGGATGCACCGAA
GTTGCCGCTCAATCTTCTCGATGCGCTGCGCGAATATGAGAAGGATGCGGAGTTGCAG
CAGGCGCTCGGCATGGAATTCTCGAAGGCCTATCTCAAGCTCAAGCAGGGGGAGTGGA
ACAGCTATTGCGCACAGTTCACCGCCTGGGAGCACCAGACCACGCTCGACGTCTGAgc
ccggttttccccgccgcccttgcggcttttcccgcgcgcgtcaaaccgcgcgggtttttcccatatcgATG

    AGR_L_1261 Gene: AGR_L_1261     GI: 15890751     BI number: AGR_L_1261     GOG: COG0788     Description: AGR_L_1261   G C  T A  C GT CG        ct TA       c  t Cg        cg Gc        gc C  c       cg A  c       cg Cg        gc Cg       c  t At       c  t Gt       c  t A  |      c  t C  |      t  c        a C  |      t  |      c  a A  |      t  |       ta C  |      t  |       gc Gt        gc       c  | At        gc        gc Gc        cg        cg Gc       c  c       gc Gc        cg        cg T  c       gc        gc C  |      A  g       cg Cg        Gc        cg Gc        Tg        cg                         tttttcccatatcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0788 Formyltetrahydrofolate hydrolase ... can be seen here     ..................................................................................................................