Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:44 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-24.50 kcal/mol
Antiterminator: Size=50 nt.     Delta G= -6.55 kcal/mol
Anti-antiterminator:   Size=25 nt.     Delta G= -8.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gaaatggcgtacaaaatcatgtgcgccccttacaggagataaattgctccgcaatttatctccggcaaagatccgtcgtcgctaaagcaacgacgtaacc
gcgacattcggccttgccgaatgcgctggacgcggggtggagcagcccggtagctcgtcaggctcataacctgaaggccgcaggttcaaatcctgccccc
gcaaccaaagtttacacccaatatcaaagggctccgaggaaactcggagccctttttgcgttcagaacgccttggaatataaaacgccaagctgaagacg
TTG

    AGR_L_1339


Gene: AGR_L_1339     GI: 15890794     BI number: AGR_L_1339     GOG: -------     Description: AGR_L_1339


           ta
          t  c
           ta
           gc
          a  c
          a  c
          a  a
          c  a
          c  t
          a  a
          a  t
          c  c
          g  a
          c  a
  a       c  a
c  a       cg        aa
t  a       cg       g  a
t  t       cg        gc
 gc        gc        at
 gc       |  t       gc
 at       |  c       cg
 cg       |  c       cg
 gc       |  g       ta
c  c       ta        cg
c  c       cg        gc
 gc        cg        gc
 gc        ta        gc
                        tttttgcgttcagaacgccttggaatataaaacgccaagctgaagacgTTG


    ..................................................................................................................