                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:70 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-16.90 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -3.90 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-15.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAGCAGCAGCAGGTGGAAGCACCGGCCGCAGCACCCAAGACGCGTCGGGCAACCGGTC
CGCGTCCGCGTCGCCCGCGTCGCACCGCCGCTGCGGAAGGTGCCGAAGGCGAAGAAGC
GCCGGCTGGTGAAGATGCTGCAGCGACGACGCTTGAGAATGCTGCTGAATAAgcagcgtca
gcaaacaagctctgcaattgaaaaactccggcttgccggagttttttgttttttggcgatgggtgcgagaccggccgccgcccaagtctgatcgcagggc
ggaattgatgccggtcaagtcagGTG

    AGR_L_1347 --- AGR_L_1346 Gene: AGR_L_1347     GI: 15890800     BI number: AGR_L_1347     GOG: -------     Description: AGR_L_1347p Gene: AGR_L_1346     GI: 15890799     BI number: AGR_L_1346     GOG: COG0542     Description: AGR_L_1346   A A  T G  A TA Cg Gc Ta Cg Gc Tg At        aa |  c      g  a |  a       ta        tt |  g       ta       c  g |  c      a  c       gc A  a      a  t       gc G  a      c  c       cg A  a      g  c       cg Gc       t  |       ta Ta       c  |       cg Ta        tg        at Cg        cg        at Gc        gc        at C  |       at        at At        at        at Gc        cg        gt                         gttttttggcgatgggtgcgagaccggccgccgcccaagtctgatcgcagggcggaattgatgccggtcaagtcagGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0542 ATPases with chaperone activity, ATP-binding subunit ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:77 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-12.00 kcal/mol Antiterminator: Size=30 nt.     Delta G= -3.90 kcal/mol Anti-antiterminator:   Size=31 nt.     Delta G=-11.70 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GAGCAGCAGCAGGTGGAAGCACCGGCCGCAGCACCCAAGACGCGTCGGGCAACCGGTC CGCGTCCGCGTCGCCCGCGTCGCACCGCCGCTGCGGAAGGTGCCGAAGGCGAAGAAGC GCCGGCTGGTGAAGATGCTGCAGCGACGACGCTTGAGAATGCTGCTGAATAAgcagcgtca gcaaacaagctctgcaattgaaaaactccggcttgccggagttttttgttttttggcgatgggtgcgagaccggccgccgcccaagtctgatcgcagggc ggaattgatgccggtcaagtcagGTG     AGR_L_1347 --- AGR_L_1346 Gene: AGR_L_1347     GI: 15890800     BI number: AGR_L_1347     GOG: -------     Description: AGR_L_1347p Gene: AGR_L_1346     GI: 15890799     BI number: AGR_L_1346     GOG: COG0542     Description: AGR_L_1346   A        gc A  T      a  a G  A       ca TA        ta Cg       g  c Gc       c  a Ta       g  a Cg       a  g       tt Gc       c  |      c  g Tg       g  |       gc At        Ac        gc A  c       At        cg G  a       Tc        cg A  g       At        ta Gc        Ag        cg Ta        Gc        at                         tttttgttttttggcgatgggtgcgagaccggccgccgcccaagtctgatcgcagggcggaattgatgccggtcaagtcagGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0542 ATPases with chaperone activity, ATP-binding subunit ... can be seen here     ..................................................................................................................