                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:13 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-11.00 kcal/mol
Antiterminator: Size=27 nt.     Delta G= -4.14 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCATCATTCCTCCGAAGCCTTCATGTTGGCCTTGCTTTCGGCTTCATCGAGTTTTTC
GAGAAGATCGAGGAATTTGTCAGGGATGCCTTCTTCCTGAACGGCATCATAGAGCTCC
CTGAGCTTGCGGGAAATCACCGCCCGCCCGGAATGTGGAACCTGGGGGGGCGCCGAGT
TGTCCGGCGAATCTTGGTCCGATTGAAACATGCTCATaacgtccggtattccttttgtgtcgtggcaagaatg
cgcggttaaaaaaatagttccggcggtccggaactttttttgcgatacacacgTTG

    AGR_L_1384 Gene: AGR_L_1384     GI: 15890816     BI number: AGR_L_1384     GOG: COG0784,COG1595     Description: AGR_L_1384 aa a  a a  t a  a a  g       gg t  t      c  t t  t       gc gc        gc gc        cg cg        cg g  |       ta cg        ta gc        gc tg        at             ttttttgcgatacacacgTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG0784 FOG: CheY-like receiver ... can be seen here [K] COG1595 DNA-directed RNA polymerase specialized sigma subunit, sigma24 homolog ... can be seen here     ..................................................................................................................