                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:44 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-11.80 kcal/mol
Antiterminator: Size=59 nt.     Delta G=-14.61 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -8.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAACGCGATCGCTGCTTGTCTGCGGAAAAATGCTGATGTCGGCGATCAGAGCTTCGAG
TGTTGCCGCAACATAGGCATCGCCCGTTGATTGTGAGCCGCAAACGGCACGCGCGAAC
CTGCGAAGATATGGCAGGTGCGGTGCGATGCGTGTAGAAACTGACATGGAATTCTCCC
CTTTCATGCGGTCTGCAACGCAAACCCAAGATAGCAAcgtgtgtatcgcaaaaaaagttccggaccgccggaa
ctatttttttaaccgcgcattcttgccacgacacaaaaggaataccggacgttATG

    AGR_L_1385 --- AGR_L_1386 Gene: AGR_L_1385     GI: 15890817     BI number: AGR_L_1385     GOG: -------     Description: AGR_L_1385p Gene: AGR_L_1386     GI: 15890818     BI number: AGR_L_1386     GOG: COG1595     Description: AGR_L_1386             c           A  g           A  t            Cg            Gt           |  g            At            Ta            At            Gc           A  g           A  c           C  a           C  a           C  a TC       A  a C  C      A  a T  C      A  a T  C      C  a AT       G  | AT        Cg GT        At        cc GC        At       a  g TA       C  c       gc AT        Gc        gc CG        Tg        cg A  |       Cg        cg GC        Ta        ta TG        Gc        ta CG        Gc        gc AT        Cg        at                         atttttttaaccgcgcattcttgccacgacacaaaaggaataccggacgttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1595 DNA-directed RNA polymerase specialized sigma subunit, sigma24 homolog ... can be seen here     ..................................................................................................................