                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:63 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-20.10 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -7.80 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-20.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGGCCGCGACGCCACCTCTTATTGGTCGATCAAAACAGACCTCAAAAATGCGGGCGC
CAACTGGAAGGACGAAAAAGTGGTGACCGACAAGGGGATCATCACCTCTCGCAGCCCT
GACGATCTCGATGCATTCGTCGCAAAGATCGTGGAAGAGGTCGAAGAAGGCCGCCACG
AACGACGCGCCGCTTAAgataccagcacattgtcgtgccgccggcttccggcggcactttttttgggagaacgatatgaaaagcagat
tactggcaggcggagcggagcgcaccttcatccttatcGTG

    AGR_L_1425 --- AGR_L_1426 --- AGR_L_1428 --- AGR_L_1429 Gene: AGR_L_1425     GI: 15890834     BI number: AGR_L_1425     GOG: COG1661     Description: AGR_L_1425p Gene: AGR_L_1426     GI: 15890835     BI number: AGR_L_1426     GOG: COG4711     Description: AGR_L_1426p Gene: AGR_L_1428     GI: 15890836     BI number: AGR_L_1428     GOG: NOG09754     Description: AGR_L_1428p Gene: AGR_L_1429     GI: 15890837     BI number: AGR_L_1429     GOG: COG0665     Description: AGR_L_1429 AG A  A G  A CG TG GC GC         a A  G      g  t G  |      A  a A  |      A  c A  |      T  c GC        Ta GC        Cg TA        Gc GC       C  a CG       C  c TA       G  a        t A  A      C  t      c  t G  C       Gt        gc A  G       Cg        gc A  A       At        cg A  C       Gc        cg CG        Cg        gc GC        At        cg CG       |  g       cg T  C      A  c       gc GC        Gc        ta CG        Cg        gc                         tttttttgggagaacgatatgaaaagcagattactggcaggcggagcggagcgcaccttcatccttatcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1661 Predicted DNA-binding protein with PD1-like DNA-binding motif ... can be seen here [S] COG4711 Predicted membrane protein ... can be seen here [E] COG0665 Glycine/D-amino acid oxidases (deaminating) ... can be seen here     ..................................................................................................................