                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:14 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-22.50 kcal/mol

                                                                        Nomenclature/Definitions

CCGTGCGCAATGGTGCAACAAGGAGTTCTCCGAACTTCTTTCCAAGGCAAAGCAGACC
ACTGATGTTGCCGAGCGCACCAAGCTTTACGAGCAGGCGCAGGTGATCTTCAAGGAAC
AGGCTCCGTGGGCGACGCTTGCGCACTCCACGCAGTTCGTTCCGATGTCCGCCAAGGT
TTCCGGCTTCACCATGAGCCCGCTTGGCGACTTCACCTTCGAAAACGTCGATATCGCT
GAGTAAtcccaaacaactggacgcgcggaagaaccctgttcttccgcgcgtcttttcaggaaaaaaccATG

    AGR_L_1478 --- AGR_L_1477 --- AGR_L_1475 --- AGR_L_1474 Gene: AGR_L_1478     GI: 15890860     BI number: AGR_L_1478     GOG: COG0601     Description: AGR_L_1478p Gene: AGR_L_1477     GI: 15890859     BI number: AGR_L_1477     GOG: COG1173     Description: AGR_L_1477p Gene: AGR_L_1475     GI: 15890858     BI number: AGR_L_1475     GOG: COG0444     Description: AGR_L_1475p Gene: AGR_L_1474     GI: 15890857     BI number: AGR_L_1474     GOG: COG4608     Description: AGR_L_1474            c          c  t           cg           at           at           gc           at           at           gc           gc           cg           gc           cg           gc           cg             tcttttcaggaaaaaaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EP] COG0601 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here [EP] COG1173 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here [EP] COG0444 ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component ... can be seen here [E] COG4608 ABC-type oligopeptide transport system, ATPase component ... can be seen here     ..................................................................................................................