                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:193 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-23.80 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-11.40 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G= -9.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCAGCCGCGCCATGAAGGTGCAGATCGCCTTTTCCTAAgcgcatttgctgcggacagtgattagctattt
tcaatcggtggcggataattccgccgccgattttttatgcatggttttgggcgtggcgcgatccagcggcgctgttaccgatatcatggatttgcgatga
ggccgcggcctcaagcagcgcaatccgctatgatgccggggattccagtctcatatttggcgaccctgaccgtcctttgccgatctgccccaccggtttg
cacattttgacgcaggtcaaaaaggtgatTTG

    AGR_L_1535 --- AGR_L_1532 --- AGR_L_1531 --- AGR_L_1529 --- AGR_L_1527 Gene: AGR_L_1535     GI: 15890886     BI number: AGR_L_1535     GOG: COG1510     Description: AGR_L_1535p Gene: AGR_L_1532     GI: 15890885     BI number: AGR_L_1532     GOG: COG4988     Description: AGR_L_1532p Gene: AGR_L_1531     GI: 15890884     BI number: AGR_L_1531     GOG: COG4987     Description: AGR_L_1531p Gene: AGR_L_1529     GI: 15890883     BI number: AGR_L_1529     GOG: COG1271     Description: AGR_L_1529p Gene: AGR_L_1527     GI: 15890882     BI number: AGR_L_1527     GOG: COG1294     Description: AGR_L_1527            ct           g  a at       a  t c  t      t  t gt       t  t cg        at gc        gc At        ta A  g      g  a       aa T  c      a  |      t  t Cg       c  |       at Cg        at        gc Ta        gc        gc T  c      g  g       cg T  a       cg        gc T  |       gt        gc C  |       tg        tg Cg        cg        gc Gt        gc        gc Cg        tg        cg Ta        tg        ta At        ta        at Gt        at        at                         ttttatgcatggttttgggcgtggcgcgatccagcggcgctgttaccgatatcatggatttgcgatgaggccgcggcctcaagcagcgcaatccgctatgatgccggggattccagtctcatatttggcgaccctgaccgtcctttgccgatctgccccaccggtttgcacattttgacgcaggtcaaaaaggtgatTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1510 Predicted transcriptional regulators ... can be seen here [CO] COG4988 ABC-type transport system involved in cytochrome bd biosynthesis, ATPase and permease components ... can be seen here [CO] COG4987 ABC-type transport system involved in cytochrome bd biosynthesis, fused ATPase and permease components ... can be seen here [C] COG1271 Cytochrome bd-type quinol oxidase, subunit 1 ... can be seen here [C] COG1294 Cytochrome bd-type quinol oxidase, subunit 2 ... can be seen here     ..................................................................................................................