Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:89 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-16.30 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -7.60 kcal/mol
Anti-antiterminator:   Size=33 nt.     Delta G= -9.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGAACCTGATGGCCAACGAACCGCAGATCGCCAACAAGACGCTTGGCATCGTGCTCAA
CAAGACCGACATGACGGAATTGCAGCGTTATGCCGGCCCCGGCGGCTCGGAGCATTAT
CACGAGAAATTCTCGGCCTATTACGGCGACGCAAAGCCGCCCGTAAAGGAAGATGCCT
GAtcatgaaacggcctggtgaaaaccgggccttttttctgctagggtacgatcgataaaccgatggcattgcccggcgaaatgcgcattgatggcggaa
agccaaatcgcaagcaggatcaatctcATG

    AGR_L_1616


Gene: AGR_L_1616     GI: 15890923     BI number: AGR_L_1616     GOG: COG0111     Description: AGR_L_1616


           GA
          A  T
  A       A  G
C  A       GC
G  A       GC
C  G       AT
A  C      |  G
 GC       |  A
 CG       A  t
|  C      A  c
 GC        Ta        aa
 GC        Gt       g  a
 CG        Cg        ta
 AT       |  a       gc
 TA       C  a       gc
 TA       C  a       tg
A  |       Gc        cg
 TA        Cg        cg
 CG        Cg        gc
 CG        Gc        gc
                        ttttttctgctagggtacgatcgataaaccgatggcattgcccggcgaaatgcgcattgatggcggaaagccaaatcgcaagcaggatcaatctcATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[HE] COG0111 Phosphoglycerate dehydrogenase and related dehydrogenases ... can be seen here

    ..................................................................................................................