                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:179 nt.     Distance to run of Ts=3 nt.   Size=35 nt.     Delta G=-12.00 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-11.40 kcal/mol
Anti-antiterminator:   Size=30 nt.     Delta G=-15.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGGTCCGTCACATGGCCTTCAATCTCGATCATCATGATGCCGCGGATCGCGGCCTCC
ACGGCATCCGCACGCAGGATGACGGTATAACCGATGATGGAACCGTCATTTTCCATTT
TTTCGATGCGCGCGCGAACCGTCGCGCGCGAGGTTTCCGTCTCCACCGCCAGATCGGA
AATGCTGCGTCGGCCATTATGGCGCAAAAGCGTGATGAGGCGTTCGTCGAGAGTGTCC
ATtatgccatttcgataaaagaattttaccagaatggtagatcatttcgataatattgccaatatttaATG

    AGR_L_1693 --- AGR_L_1691 Gene: AGR_L_1693     GI: 15890962     BI number: AGR_L_1693     GOG: COG0010     Description: AGR_L_1693p Gene: AGR_L_1691     GI: 15890961     BI number: AGR_L_1691     GOG: COG2423     Description: AGR_L_1691             C           A  G           C  C           G  A            CG            CG        TG            TA       A  A            AT       G  T            CG        CG CG       G  A       CG G  G       GC       A  A C  C       CG       A  | T  C      A  G      T  | AT       C  T      A  | GC       C  A       TA GC       T  T       GC C  A      C  A       GC GC       C  A       CG CG        GC        AT CG        GC        GC GC        CG        TA TA       |  A       AT AT        GT        GT GC        CG        GT                         TCCATTTTTTCGATGCGCGCGCGAACCGTCGCGCGCGAGGTTTCCGTCTCCACCGCCAGATCGGAAATGCTGCGTCGGCCATTATGGCGCAAAAGCGTGATGAGGCGTTCGTCGAGAGTGTCCATtatgccatttcgataaaagaattttaccagaatggtagatcatttcgataatattgccaatatttaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0010 Arginase/agmatinase/formimionoglutamate hydrolase, arginase family ... can be seen here [E] COG2423 Predicted ornithine cyclodeaminase, mu-crystallin homolog ... can be seen here     ..................................................................................................................