                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:178 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-11.40 kcal/mol
Antiterminator: Size=18 nt.     Delta G= -8.60 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-22.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGTCTGGCCGAGATATCCGCACTGCGCTGGGACACCATGACATGCGGTACGGCGGCGG
GCTTGACAAGCAGGCCGCGCACCATCGCATCGGTGATGGCACCCGTTCCGATGAAACC
GATTTTCTGGGGAAGGGACATgaatactccactgcggcgaatgggccgacagaggcatcggctgtgtcatttccatccgatgcta
agttctccgtcgggaattgtcgacaagcagatagcgttaatttgcgattgaaacggagcccgccacactcgatgatgtgggactgctattgaatttgacA
TG

    AGR_L_1734 Gene: AGR_L_1734     GI: 15890983     BI number: AGR_L_1734     GOG: NOG11223     Description: AGR_L_1734   A C  A A  G GC TA TG                   A CG                 C  C GC                  GC GC                  GC |  G                 TG GC                  AT CG                  GT GC                 T  | G  A                 GC C  |                 GC GC                  CG GC                  TA C  |       TC        AT A  |      A  G       CG TA        CG       |  A GT        GT       |  A GC        CG       |  A CG        TA       |  C GC        AT        GC TA        CG        CG AT        CG        TA                         TTTTCTGGGGAAGGGACATgaatactccactgcggcgaatgggccgacagaggcatcggctgtgtcatttccatccgatgctaagttctccgtcgggaattgtcgacaagcagatagcgttaatttgcgattgaaacggagcccgccacactcgatgatgtgggactgctattgaatttgacATG     ..................................................................................................................