                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:87 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -9.30 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -9.70 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G=-16.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATCACCGTGCCGGGCGTACCCATTTCATCACCATAATAAAGGTGATAAACGCTGGGTT
CGTCGAAGTTGACGGTCTTCTTCACCCGGCGCAGGCCGAGCGTATCGGTGAAAAAGCT
GTTGTTCTGCCGCGCATCCGACGCCATCGAGGTAACGTGGTGCAGGCCCTTGATATCC
TTGATCATCATcggcgcctttcgtggtcgctgtgtttgtttcgatggacaaagatgtaacccgcttgatcacgttgcggaattgcaatattt
ctctcgaatgaattgcgatttttgaaataatgcgATG

    AGR_L_1754 Gene: AGR_L_1754     GI: 15890991     BI number: AGR_L_1754     GOG: COG0583     Description: AGR_L_1754             G           T  A           T  T           C  A   C       C  T T  G      C  C A  A       GC CG        GT CG        AT GT        CG C  A      |  A A  A      |  T       tc GC        GC       t  g CG        TA       t  t |  T       GT        cg CG        GC        cg TG        TA       |  t AT       |  T       gc CG        Gc        cg GC        Cg        gc C  A      A  g       gt G  |      A  c       cg CG        Tg       T  | CG        Gc        At GC        Gc        Cg                         tttgtttcgatggacaaagatgtaacccgcttgatcacgttgcggaattgcaatatttctctcgaatgaattgcgatttttgaaataatgcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0583 Transcriptional regulator ... can be seen here     ..................................................................................................................