Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:110 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-24.50 kcal/mol
Antiterminator: Size=51 nt.     Delta G= -6.48 kcal/mol
Anti-antiterminator:   Size=17 nt.     Delta G= -6.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aagatccgtcgtcgctaaagcaacgacgtaaccgcgacattcggccttgccgaatgcgctggacgcggggtggagcagcccggtagctcgtcaggctcat
aacctgaaggccgcaggttcaaatcctgcccccgcaaccaaaatttaaacccaatatcaaaagggctccgaggaaactcggagccctttttgcgttcaga
gcgccttgaagataagaacgccaagctgaagacgttgcttgccgaggtgatgctggacagcgccattttgaaggatgttgcttcaaaaaaatggtaacgc
ATG

    AGR_L_1813


Gene: AGR_L_1813     GI: 15891023     BI number: AGR_L_1813     GOG: COG0454     Description: AGR_L_1813


            a
          t  a
          t  a
          t  c
          a  c
          a  c
          a  a
          a  a
          c  t
          c  a
          a  t
          a  c
          c  a
          g  a
          c  a
          c  a
           cg        aa
           cg       g  a
           cg        gc
  a        gc        at
c  a      |  t       gc
t  a      |  c       cg
t  t      |  c       cg
 gc       |  g       ta
 gc        ta        cg
 at        cg        gc
 cg        cg        gc
 gc        ta        gc
                        tttttgcgttcagagcgccttgaagataagaacgccaagctgaagacgttgcttgccgaggtgatgctggacagcgccattttgaaggatgttgcttcaaaaaaatggtaacgcATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[KR] COG0454 Histone acetyltransferase HPA2 and related acetyltransferases ... can be seen here

    ..................................................................................................................