                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:30 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-18.60 kcal/mol
Antiterminator: Size=35 nt.     Delta G=-13.14 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G=-14.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AACGGCCAGTCCGGCCGTAAATACGATGCCTACACCACGCTGGATATCGGCGCGAAAT
ATGCGGTTGCCGAGAATGTCGACCTCAATGCCGCCGTCTATAATGTCTTCGACAAGGA
CGTCGGCACCGATGATTTCAACACGGTCATGGAAGGCCGTCGTTTCTGGATCAGCATG
ACGGCAAAATTCTGActgagccttagtgactgagccttagtgactgggccccttagtagcggaatttcaggggcgcccgccgggcgcct
ctttttttgcccaatcgcctattgacctcaactatagTTG

    AGR_L_1858gl Gene: AGR_L_1858gl     GI: 15891047     BI number: AGR_L_1858gl     GOG: COG0789     Description: AGR_L_1858gl   c g  c at gt ta cg        gg at       c  a g  g      g  a ta       a  t gc       t  t at       g  t tg       a  c        c tg        ta       g  c cg        tg        cg |  c       cg        cg |  c       cg        cg c  c       cg        gc gc       |  c       cg at        cg        gc gt        gc        gc ta        gc        gt cg        gc        gc At        tg        at                         ttttttgcccaatcgcctattgacctcaactatagTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0789 Predicted transcriptional regulators ... can be seen here     ..................................................................................................................