Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:193 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -8.50 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-13.10 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G=-24.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGCTCGGCAGCGCCTTCATTCATCTCGCATGGCTCGGGCTGGTCGGCCCGAACCTGTG
GTGGGCTCTCGCTCTATCCTTGGTCTACGCCATCGGCGTTTTCCGTTTTGTCTAGagcg
ggatggcgaaaagtgtgagcggttttcgcctgaaatcccgctctaactttatgatgtagatcaggattcagattttaggtcgatctgacctaaaatcatc
ctgatctagagcagaaaaaaggtgcggcggaggaaaaccgcacccgcagacttcatgcaatcgcaacccttgggaggactgatATG

    AGR_L_1912


Gene: AGR_L_1912     GI: 15891071     BI number: AGR_L_1912     GOG: COG1653     Description: AGR_L_1912


 GT
G  C
 TG
 CG
 GC
 GC
 GC
 CG
 TA
C  A
 GC        CT
 GC       T  C
T  |       CG
 AT        GC
 CG        GT
 GT        GC
 CG       |  T
 TG       |  A
C  T      T  T
T  |       GC
A  |       GC
C  |      T  T        T
T  |      G  T      A  C
T  |      T  |       CG
A  |       CG        CG
C  |       CG        GC
T  |       AT        CG
 TG       A  C       AT
 CG       G  T      T  T
 CG       C  A      C  T
 GC       C  C      T  T
C  T       CG        GC
 GC        GC        GC
 AT        GC        TG
                        TTTTGTCTAGagcgggatggcgaaaagtgtgagcggttttcgcctgaaatcccgctctaactttatgatgtagatcaggattcagattttaggtcgatctgacctaaaatcatcctgatctagagcagaaaaaaggtgcggcggaggaaaaccgcacccgcagacttcatgcaatcgcaacccttgggaggactgatATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[G] COG1653 ABC-type sugar transport system, periplasmic component ... can be seen here

    ..................................................................................................................