                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:193 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -8.50 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-13.10 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G=-24.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGCTCGGCAGCGCCTTCATTCATCTCGCATGGCTCGGGCTGGTCGGCCCGAACCTGTG
GTGGGCTCTCGCTCTATCCTTGGTCTACGCCATCGGCGTTTTCCGTTTTGTCTAGagcg
ggatggcgaaaagtgtgagcggttttcgcctgaaatcccgctctaactttatgatgtagatcaggattcagattttaggtcgatctgacctaaaatcatc
ctgatctagagcagaaaaaaggtgcggcggaggaaaaccgcacccgcagacttcatgcaatcgcaacccttgggaggactgatATG

    AGR_L_1912 Gene: AGR_L_1912     GI: 15891071     BI number: AGR_L_1912     GOG: COG1653     Description: AGR_L_1912 GT G  C TG CG GC GC GC CG TA C  A GC        CT GC       T  C T  |       CG AT        GC CG        GT GT        GC CG       |  T TG       |  A C  T      T  T T  |       GC A  |       GC C  |      T  T        T T  |      G  T      A  C T  |      T  |       CG A  |       CG        CG C  |       CG        GC T  |       AT        CG TG       A  C       AT CG       G  T      T  T CG       C  A      C  T GC       C  C      T  T C  T       CG        GC GC        GC        GC AT        GC        TG                         TTTTGTCTAGagcgggatggcgaaaagtgtgagcggttttcgcctgaaatcccgctctaactttatgatgtagatcaggattcagattttaggtcgatctgacctaaaatcatcctgatctagagcagaaaaaaggtgcggcggaggaaaaccgcacccgcagacttcatgcaatcgcaacccttgggaggactgatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1653 ABC-type sugar transport system, periplasmic component ... can be seen here     ..................................................................................................................