                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:8 nt.     Distance to run of Ts=1 nt.   Size=28 nt.     Delta G= -7.70 kcal/mol
Antiterminator: Size=38 nt.     Delta G=-13.20 kcal/mol
Anti-antiterminator:   Size=33 nt.     Delta G=-11.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCATGCCTCGATCTCGATCAGCGCATGCACCGACGAGGGCGGCAAATCGGTGCCGGCA
AAATCACCCCCCATGAAACCAAGCTCGCGGACAAGCTGGCGTGAGTTGGAGCGAATGT
CGTTTATGGGGGGAAATTGTTCGGTCAAgttcgatccattgtggttgcatcttgcaactataaccatattgcatctggc
ttgccaagattgcgtccggcgtaaaaagctggccttctgcgcaaaagcgggcaatctgctggccgggacactgacaatggcggtgaaaccgctcttttca
gtaagGTG

    AGR_L_1947 Gene: AGR_L_1947     GI: 15891090     BI number: AGR_L_1947     GOG: -------     Description: AGR_L_1947            aa           c  a           g  a   a        cg a  a       gc t  a       tg g  a       cg cg        tg gc       |  c        a gt       |  a      a  t cg       |  a      c  g cg       |  t      a  g |  c      |  c       gc |  c      |  t       tg |  t      |  g       cg |  t      |  c       at |  c      t  t       cg |  t       cg       |  a tg        cg       a  a gc        gc       g  a cg        gc        gc gc        tg        gc ta        cg        cg                         ctcttttcagtaagGTG     ..................................................................................................................