Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:199 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-10.70 kcal/mol
Antiterminator: Size=49 nt.     Delta G=-27.07 kcal/mol
Anti-antiterminator:   Size=37 nt.     Delta G=-16.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gagcggttttttcgttccggcccaaaacggtggagcggtgggggtatatatatacccaccaccccaccggtccccgaaccaccaggaccgtagaggttat
tttcgccgtggatggctacgcagtctaagcgataccttaagggcgttgaaattgaagttggggtttaatctgtgaaataccctggacatatcgagcaggc
gcgcgccgctatcctccgttggcaccgaaacttgcggacgacccgcaagcagtgcggcgcaaagcggaaacatgatgggaaaccctgccagcagatcgct
ATG

    AGR_L_1978 --- AGR_L_1979


Gene: AGR_L_1978     GI: 15891103     BI number: AGR_L_1978     GOG: NOG41989     Description: AGR_L_1978p
Gene: AGR_L_1979     GI: 15891104     BI number: AGR_L_1979     GOG: -------     Description: AGR_L_1979


           at
          t  a
          a  c
          t  c
          a  c
  A       t  a
t  T      a  c        c
 cG       t  c      a  c
 gc       g  a      a  a
 cg        gc       g  c
 tg        gc       c  c
 at        gc       c  a
|  g       gc        cg
g  g       ta        cg
a  a       gc        ta
 cg        gc        gc
 gc        cg        gc
a  |      g  g       cg
 cg        at       c  t
 cg        gc       a  a
g  t       gc       c  g
t  g      t  |      c  a
 cg        gc        cg
 cg        gc        cg
 cg        cg        at
                        tattttcgccgtggatggctacgcagtctaagcgataccttaagggcgttgaaattgaagttggggtttaatctgtgaaataccctggacatatcgagcaggcgcgcgccgctatcctccgttggcaccgaaacttgcggacgacccgcaagcagtgcggcgcaaagcggaaacatgatgggaaaccctgccagcagatcgctATG
    ..................................................................................................................