                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:139 nt.     Distance to run of Ts=1 nt.   Size=29 nt.     Delta G=-12.80 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-13.20 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-14.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATACCGGAAGAATTGTGGCAGGCCTTGCAGAAAAAGGGCCTGCTGGCGCCGATGCCGG
TTTTGATGGAGACGTGAggatcatcaacgccagcaatcgtaaccgagctgcgcgggaccggggggtagtggcgaaaatcgacggcccc
cattatttgcttctttcatgaacgacttgcttggaaatcatgggagaggttggttgcgggcgtgaaaccggctaaagaaatttttaccggtgagtccggt
ttttgatgggagacgacggacgtgtcaaaacaagaggcgaatgcgggccattccTTG

    AGR_L_2035 Gene: AGR_L_2035     GI: 15891135     BI number: AGR_L_2035     GOG: COG1802     Description: AGR_L_2035   T         t G  G      c  g C  A      g  c A  g      a  g G  g       gc A  a       cg Gt        cg Gc       a  g Ta       a  a At       t  c        a Gc        gc       a  a Ta        cg       a  t Ta        tg        gc T  c      |  g       cg Tg       a  g      g  a Gc       a  g      g  c Gc        cg       t  g C  a       gt       g  | Cg       |  a      a  | Gc       |  g       tg |  a       at        gc Ta        cg        gc At        cg        gc Gc        gc        gc Cg        cg        gc                         attatttgcttctttcatgaacgacttgcttggaaatcatgggagaggttggttgcgggcgtgaaaccggctaaagaaatttttaccggtgagtccggtttttgatgggagacgacggacgtgtcaaaacaagaggcgaatgcgggccattccTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1802 Transcriptional regulators ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:147 nt.     Distance to run of Ts=1 nt.   Size=29 nt.     Delta G=-12.80 kcal/mol Antiterminator: Size=46 nt.     Delta G=-13.20 kcal/mol Anti-antiterminator:   Size=48 nt.     Delta G=-14.60 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ATACCGGAAGAATTGTGGCAGGCCTTGCAGAAAAAGGGCCTGCTGGCGCCGATGCCGG TTTTGATGGAGACGTGAggatcatcaacgccagcaatcgtaaccgagctgcgcgggaccggggggtagtggcgaaaatcgacggcccc cattatttgcttctttcatgaacgacttgcttggaaatcatgggagaggttggttgcgggcgtgaaaccggctaaagaaatttttaccggtgagtccggt ttttgatgggagacgacggacgtgtcaaaacaagaggcgaatgcgggccattccTTG     AGR_L_2035 Gene: AGR_L_2035     GI: 15891135     BI number: AGR_L_2035     GOG: COG1802     Description: AGR_L_2035   C         t A  G      c  g G  T      g  c A  G      a  g G  A       gc G  g       cg Tg        cg Aa       a  g Gt       a  a Tc       t  c        a Ta        gc       a  a Tt        cg       a  t Tc        tg        gc G  a      |  g       cg Ga       a  g      g  a Cc       a  g      g  c Cg        cg       t  g G  c       gt       g  | Tc       |  a      a  | Aa       |  g       tg |  g       at        gc Gc        cg        gc Ca        cg        gc Ca        gc        gc Gt        cg        gc                         attatttgcttctttcatgaacgacttgcttggaaatcatgggagaggttggttgcgggcgtgaaaccggctaaagaaatttttaccggtgagtccggtttttgatgggagacgacggacgtgtcaaaacaagaggcgaatgcgggccattccTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1802 Transcriptional regulators ... can be seen here     ..................................................................................................................