                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:109 nt.     Distance to run of Ts=3 nt.   Size=32 nt.     Delta G=-12.20 kcal/mol
Antiterminator: Size=55 nt.     Delta G=-51.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCTGACCGCAGTTCTGGCTGCAGCAACGCTTGCCCTTGTACTGGTGCAGCCGCGCCGC
TGAtctcccggcggtgatcgccaatgcatgaacggtgtagaacgcctgccgtgatggcgcgagaattcaggatattctcgcgccatcacggcaggcga
acgacattctatcgcccagccgctacttttttctcccgcaaggatgtcgaggtgagactggcggcttgagatggtgtccagcagagggtatcaggtgctc
cgatcctcgccggaccttcggcaagcaacaaggtatatcctgacATG

    AGR_L_2056 Gene: AGR_L_2056     GI: 15891145     BI number: AGR_L_2056     GOG: COG4286     Description: AGR_L_2056   g a  g c  a t  t ta at at gc at gc cg gc         a cg       c  t gc       a  t gc       g  c ta       c  t at       a  a gc        at ta        gc gc        cg cg        gc cg        gc gc       |  c ta       a  a cg        cg cg        gc gc        gc cg        cg             ctacttttttctcccgcaaggatgtcgaggtgagactggcggcttgagatggtgtccagcagagggtatcaggtgctccgatcctcgccggaccttcggcaagcaacaaggtatatcctgacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4286 Uncharacterized conserved protein related to MYG1 family ... can be seen here     ..................................................................................................................