                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:201 nt.     Distance to run of Ts=3 nt.   Size=25 nt.     Delta G=-20.20 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -9.79 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G= -6.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCTGGAACTGCCGGCTCAATAAgccggacgggaacggacagggcaatttgccgcacacataacaccggctccggacaacggggc
cggtttcttattttccctatgaaaacagacatctgcagatcaaattttgccaaaagacagcctgcggctgcgccggccccggaaatagcctccgccggtg
gtttaatcctgaagaatttcgtctagaacacgatgaacaaactatcggcctatgcgtatagaccgggcatttccggccaagccgcgtcacggtttgtgtt
taggcgctaacagaagATG

    AGR_L_2129 --- AGR_L_2127 --- AGR_L_2125 Gene: AGR_L_2129     GI: 15891179     BI number: AGR_L_2129     GOG: COG0276     Description: AGR_L_2129p Gene: AGR_L_2127     GI: 15891178     BI number: AGR_L_2127     GOG: COG0330     Description: AGR_L_2127p Gene: AGR_L_2125     GI: 15891177     BI number: AGR_L_2125     GOG: COG1585     Description: AGR_L_2125             t           a  t           a  t            cg            gc ca        gc a  g      |  g a  a      |  c ta       |  a cg       |  c |  A      |  a gT       |  c cG       |  a gc       |  t g  g      g  a        c a  g      a  a      a  a tg       c  c      g  a ta       a  a       gc ta        gc        cg gc        gc        cg |  g       cg        tg |  g      a  g       cg ta       a  c       gc gc        gt        gc ta        gc        cg tg        gc        cg tg        cg        at                         ttcttattttccctatgaaaacagacatctgcagatcaaattttgccaaaagacagcctgcggctgcgccggccccggaaatagcctccgccggtggtttaatcctgaagaatttcgtctagaacacgatgaacaaactatcggcctatgcgtatagaccgggcatttccggccaagccgcgtcacggtttgtgtttaggcgctaacagaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0276 Protoheme ferro-lyase (ferrochelatase) ... can be seen here [O] COG0330 Membrane protease subunits, stomatin/prohibitin homologs ... can be seen here [OU] COG1585 Membrane protein implicated in regulation of membrane protease activity ... can be seen here     ..................................................................................................................