                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:148 nt.    Distance to gene:65 nt.     Distance to run of Ts=1 nt.   Size=30 nt.     Delta G=-17.80 kcal/mol
Antiterminator:    Distance from promoter:123 nt. Size=40 nt.     Delta G= -8.40 kcal/mol
Anti-antiterminator:    Distance from promoter:114 nt.    Size=24 nt.     Delta G= -3.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TCGTCA-tatgct. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGTCAATGTCTGCCACgtcctctatgctcctcgttcagtgccttttttgggcctttagcgggtgaatttccggcatccggtaaaatt
ccagcccttgcggccatctcctttcacaaggggatagcaggctcttgttatctgggcgaccttcatgtataggctccgcatcgaattgggaagccatagc
ccatctggtctatggcttcatttattgaaatggctcagttgacgcaattgcggcaaatggaccgcatgtcacttaaccaggaagattgtcATG

    AGR_L_2181 Gene: AGR_L_2181     GI: 15891206     BI number: AGR_L_2181     GOG: COG0254     Description: AGR_L_2181            ga           c  a           t  t            at            cg           g  |            cg            cg        tc           |  a      a  t tg        ta        cg a  t       cg        cg c  a       gc       c  t t  t       gc        gc ta       |  a       at cg        at        ta cg        ta        at |  c      |  g       cg |  t      a  c       cg a  c      t  c       gc gc        gc        at cg        ta        at gc        at        gc                         atttattgaaatggctcagttgacgcaattgcggcaaatggaccgcatgtcacttaaccaggaagattgtcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0254 Ribosomal protein L31 ... can be seen here     ..................................................................................................................