                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:198 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-25.20 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -7.80 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G= -3.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCAACCGCATGTCGGACACGGCCGTCGCCTTCGCGAAGACCATCTAAgcaaaacgcatcgatcaa
agcaggtccggcgggagcaatcccgccggattttttattctcgattttcctcccccatgccgccaagttttcaatttcctgcctttgtctggtccatttt
gaaacggacaagagggacagggataatggtcgtgcgcaatgcacttcggccctgccgtatctttcgatacaccccgccttgcgtcgcctttcaacgccac
ccagatagcgctgacagaccgcaacccgtggcgcaTTG

    AGR_L_2194 --- AGR_L_2193 Gene: AGR_L_2194     GI: 15891211     BI number: AGR_L_2194     GOG: COG3263     Description: AGR_L_2194p Gene: AGR_L_2193     GI: 15891210     BI number: AGR_L_2193     GOG: COG0126     Description: AGR_L_2193   C C  A       ag A  T      a  c GC       a  a AT        cg A  A       tg        ca G  A       at       g  a Cg        gc        at Gc       c  c       gc |  a      t  g       gc C  a      a  |       gc T  a       cg        cg T  a       gc        gc C  c       cg        gc Cg       a  g       cg Gc       a  g       cg C  a      a  a       ta T  t      a  |       gt Gc        cg        gt Cg        gc        at                         tttattctcgattttcctcccccatgccgccaagttttcaatttcctgcctttgtctggtccattttgaaacggacaagagggacagggataatggtcgtgcgcaatgcacttcggccctgccgtatctttcgatacaccccgccttgcgtcgcctttcaacgccacccagatagcgctgacagaccgcaacccgtggcgcaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG3263 NhaP-type Na+/H+ and K+/H+ antiporters with a unique C-terminal domain ... can be seen here [G] COG0126 3-phosphoglycerate kinase ... can be seen here     ..................................................................................................................