                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:92 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-15.00 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -5.50 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-13.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ccggccgaatcgtccggtttcaggccttcccaacaatcacgaggttattacccgatttaccatcccgtcaatcaaaccagtgcattgaggcgttttgctc
tgtggatgaacgaagaagcgccgggccccatcgcacgatttttggcgggacagccggttttctaaacgatttttatcctcgggcgaaccgcaattgcccg
tggatttattgacttgcctgcctcacctgctatggatcaacccgctttttggatagttgcgtaaaactatctcctttcacccggaacagacggaaaagcc
ATG

    AGR_L_2197 Gene: AGR_L_2197     GI: 15891213     BI number: AGR_L_2197     GOG: COG0021     Description: AGR_L_2197   t t  t at gt cg a  | cg gc cg tg        tt a  g      t  t c  a       ta         g c  c       at       c  c c  a       gc       c  a cg       c  c      a  a gc       a  t       at g  |      a  c       gt gc       a  g       cg cg        tg        gc cg        cg        gc gt       t  c       gc c  |       tg        cg gt        ta       t  t at        ta        cg at        gc        cg gc        gc        ta                         tttattgacttgcctgcctcacctgctatggatcaacccgctttttggatagttgcgtaaaactatctcctttcacccggaacagacggaaaagccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0021 Transketolase ... can be seen here     ..................................................................................................................