Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:93 nt.     Distance to run of Ts=1 nt.   Size=22 nt.     Delta G=-16.70 kcal/mol
Antiterminator: Size=12 nt.     Delta G= -4.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAATGCCGCCATGGTGGAAGAGACGACGGCGGCCATCCACAATCTCGCTTCCGAAGCC
GGTGAAATGGACGGCAGGCTCGGAGAGTTCGTGCTGGCTTCAGAAAACGAAACAGTGC
GGTATCACGAAAAGACACAATTCCGGCGGGCGGGCTGAgccggccggcggacaaaaggcaggggcctcctcg
gagaggccccaatttttttgaaccatccatcaattctatgcgacttctctggtaaatcgggacgcgcgccttacatccgcagcaaagatttgaatttctg
caggagcgtccgATG

    AGR_L_2217


Gene: AGR_L_2217     GI: 15891222     BI number: AGR_L_2217     GOG: COG2141     Description: AGR_L_2217



           cg
          t  g
          c  a
           cg
           ta
 gg        cg
a  g       cg
 cg        gc
 gc        gc
 gc        gc
 at        gc
            aatttttttgaaccatccatcaattctatgcgacttctctggtaaatcgggacgcgcgccttacatccgcagcaaagatttgaatttctgcaggagcgtccgATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[C] COG2141 Coenzyme F420-dependent N5,N10-methylene tetrahydromethanopterin reductase and related flavin-dependent oxidoreductases ... can be seen here

    ..................................................................................................................