                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:165 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-25.80 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-15.82 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G=-12.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TATTCGATCGACCTGACGGGCTACAACGAACAGCTCATCAAGACGCCGACCTTCGCTT
CGGATCCGGCCTGGTCGCCGCTTCTGGACTGAtatgactgccatgacggcgccggcatgaaccggcgccgtcatgt
tttacttgataccacagggacgtgcgcctctttcttgccgcaaagtgttgtgagggagcaaaaaagcgggacatttcctttctgttaaccataagcgttt
gtcggctattaaccgcgatcagttagtgtccagcaacgttattgaaatcctaaggagagaccggcgATG

    AGR_L_2246 Gene: AGR_L_2246     GI: 15891235     BI number: AGR_L_2246     GOG: COG2885     Description: AGR_L_2246 AT         a G  C      t  t GC       A  g CG       G  a T  |      T  c T  |      C  t CG       A  g GC        Gc C  C       Gc T  T       Ta        tg T  |      C  t      a  a CG        Tg       c  a CG        Ta        gc AT       C  |       gc GC        Gc        cg CG        Cg        cg |  C       Cg        gc |  C       Gc        cg CG        Cg        gc GC       T  |       gc C  T       Gc        cg AT        Gc        at GC        Tg        gc AT        Cg        ta                         tgttttacttgataccacagggacgtgcgcctctttcttgccgcaaagtgttgtgagggagcaaaaaagcgggacatttcctttctgttaaccataagcgtttgtcggctattaaccgcgatcagttagtgtccagcaacgttattgaaatcctaaggagagaccggcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG2885 Outer membrane protein and related peptidoglycan-associated (lipo)proteins ... can be seen here     ..................................................................................................................