                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:98 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-11.70 kcal/mol
Antiterminator: Size=12 nt.     Delta G= -6.40 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-22.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGAAACCGGCAATGGCGGGTCTGCCGCAAATTGCCGCAGCGGCCGAAGGATGGGTTTC
CACGCCTGAGGTTGCCATCACGCCCAGGCTTGCCCCTTTCGATCTTTTCCTGCCGCGT
TTCGACCTTGAGTTGGCGAATGCAATCGCCAATTTATTCGGCCGGCCGGCCTACCCAC
AGCCCCCGGTTTAAatccggcctctttttcgtgaattgccatggaatagtttttacaccaaaacgcatcagataatgcgctttgccttgg
caacagcatatgtcgtccttatgttaggggcacataATG

    AGR_L_2253 Gene: AGR_L_2253     GI: 15891238     BI number: AGR_L_2253     GOG: COG0465     Description: AGR_L_2253 GC T  A A  A AT GC CG GC GC TA TA                  GC GT                 A  C AT                 C  C GT                 A  C TA                 C  C T  T                 CG C  |                 CG C  |                 AT AT                 |  T GC                 |  T CG                 |  A T  |                T  A T  |                C  a TG                 C  t GC        GC        Gc C  |      G  C       Gc GC        CG        Cg CG        CG        Cg CG        GC        Gc GC        GC        Gc                         tctttttcgtgaattgccatggaatagtttttacaccaaaacgcatcagataatgcgctttgccttggcaacagcatatgtcgtccttatgttaggggcacataATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0465 ATP-dependent Zn proteases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:148 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -8.90 kcal/mol Antiterminator: Size=27 nt.     Delta G= -7.10 kcal/mol Anti-antiterminator:   Size=56 nt.     Delta G=-10.05 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TGAAACCGGCAATGGCGGGTCTGCCGCAAATTGCCGCAGCGGCCGAAGGATGGGTTTC CACGCCTGAGGTTGCCATCACGCCCAGGCTTGCCCCTTTCGATCTTTTCCTGCCGCGT TTCGACCTTGAGTTGGCGAATGCAATCGCCAATTTATTCGGCCGGCCGGCCTACCCAC AGCCCCCGGTTTAAatccggcctctttttcgtgaattgccatggaatagtttttacaccaaaacgcatcagataatgcgctttgccttgg caacagcatatgtcgtccttatgttaggggcacataATG     AGR_L_2253 Gene: AGR_L_2253     GI: 15891238     BI number: AGR_L_2253     GOG: COG0465     Description: AGR_L_2253 TT T  C C  G C  A C  T C  C G  T T  T T  T C  T GC GC AT CG |  C C  C        A CG       G  G GC       T  T CG       T  T AT        CG C  T       CG        GC T  T      A  |      T  A A  |       GC       A  A C  |       CG        AT C  |      T  |       GC GC        TA        CG TG        TA        GC TA        GT        GC GC        CG        TA GC        GC        TA                         TTTATTCGGCCGGCCGGCCTACCCACAGCCCCCGGTTTAAatccggcctctttttcgtgaattgccatggaatagtttttacaccaaaacgcatcagataatgcgctttgccttggcaacagcatatgtcgtccttatgttaggggcacataATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0465 ATP-dependent Zn proteases ... can be seen here     ..................................................................................................................