                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:126 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-14.80 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-15.90 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-16.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGCCCTTCCGGCACGGAGCCGCTGATCCGCGTCATGGCGGAGGGCGACGATAGCGCA
AAGGTGGAAAAGATCGTCAACGATCTCGTCGGCGTCATCTCCAGTGCCCGCTCGGCCG
CGTGAgttgccgtgacagtaacgaaagacaaaagccggccgtcgagccggctttttctttgagtatttgctaataaatatagtgaatcatcgtggtt
aatcgggacttaaccattttacgtcaatctccatgactgaacagttcactggcatctgctgccgaaaacgcacgtgcctcttctggaGTG

    AGR_L_2258 Gene: AGR_L_2258     GI: 15891240     BI number: AGR_L_2258     GOG: COG3637     Description: AGR_L_2258 CT         a G  C      c  g CG       a  t CG       g  a C  C       ta GC        gc TG        cg GC       |  a A  G      c  a C  T      g  a CG        tg TA        ta Cg        gc T  t      |  a A  |      |  a       tc C  |      A  a      g  g T  |      G  a      c  a Gt        Tg        cg Cg        Gc        gc Gc       C  |       gc Gc        Gc        cg Cg        Cg        cg T  |       Cg        gc Gt        Gc        at Cg        Gc        at Ta        Cg        at                         ttctttgagtatttgctaataaatatagtgaatcatcgtggttaatcgggacttaaccattttacgtcaatctccatgactgaacagttcactggcatctgctgccgaaaacgcacgtgcctcttctggaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG3637 Opacity protein and related surface antigens ... can be seen here     ..................................................................................................................