                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:32 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -7.80 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -7.80 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G=-14.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tcatctccgaaagcgcgaggctcgcctatccgatccgtgacggcgtgccgatcatgctgatttcagaagcgcgcaaaatagaagaatagtctcccttctt
ccgctctccacagattgtcatgtcgcgaattgacgaagatgcgttgacaaccatgcgtggatttgaccagagtcccgcccgacatgtctgttgcggggag
aatactgatgtcgttgcgcgctcttgtccgggtctcgttggttgcggtctctaccgccttcatttttcttccagccacggcagcagaaccttcgcggaag
GTG

    AGR_L_2284 --- AGR_L_2286 Gene: AGR_L_2284     GI: 15891250     BI number: AGR_L_2284     GOG: COG2373     Description: AGR_L_2284p Gene: AGR_L_2286     GI: 15891251     BI number: AGR_L_2286     GOG: COG4953     Description: AGR_L_2286 ga a  a g  t g  a gc gt cg g  | t  |       gt t  |      t  c g  |      t  c t  |       cg c  |       tg t  |       cg g  |       gt ta       |  c at       c  t cg        gc at        cg gc        gt cg       |  t |  t      |  g       tc c  t      |  g      c  t cg       |  t       ta gc       t  t       gc cg        tg        gc c  c       gc        cg c  |       cg        gc tg        tg       t  c gc       g  t      t  t at       t  c       gt gc        at        gc at        gc        ta                         tttttcttccagccacggcagcagaaccttcgcggaagGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG2373 Large extracellular alpha-helical protein ... can be seen here [M] COG4953 Membrane carboxypeptidase/penicillin-binding protein PbpC ... can be seen here     ..................................................................................................................