                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:90 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G= -8.50 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -3.90 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-13.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGCAGCCCAGCGTCTAATTCCGGCTTCAAAAGCGCGTTGATGGCCCGGTGACGCTCG
ATGCGAGACTTGCCGGAAAAGCTTTCAGACACTATCTGAACACGCATatgcgtctcgcccgtgcc
tgtcatatccggctggtggccagcatgcatccggctttcatcgacaaccctcaggcgttccggcgaaaagctctgccgaagctttgtttctatgcgttct
cgcagggacatgcagagggctccatttctgttttcggtctttaaaaggggctacctaaaagcctgtaacattccgctTTG

    AGR_L_2405 Gene: AGR_L_2405     GI: 15891316     BI number: AGR_L_2405     GOG: COG2214     Description: AGR_L_2405 gc a  a c  t cg gc g  a        c t  t      t  a gc        cg        ag gc        cg       a  c tg       |  c      a  t cg        cg       a  c gc        at        gt gt        at        cg c  t      c  c       gc c  t      a  |       gc t  c       gc        cg a  a       cg       c  a t  t      t  g      t  a a  c      a  c      t  | cg        cg       g  | ta        ta        cg gc        ta        gc ta        ta        gt                         ttgtttctatgcgttctcgcagggacatgcagagggctccatttctgttttcggtctttaaaaggggctacctaaaagcctgtaacattccgctTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG2214 DnaJ-class molecular chaperone ... can be seen here     ..................................................................................................................