                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-18.90 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -6.62 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G=-16.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CACGCCAACAACAAGACCAAGCGCCGGTTCCTTCCGAATCTCTGCCAGGTCACGTTGA
TCTCCGATGCTCTCGGCCAGCGTTTCCGCCTGCGTGTTTCCGCAGCCGCTCTGCGCTC
CGTTGAACACCGTGGTGGCCTCGATGCCTTCCTTCTGAAGTCCGGCGAAAACGAACTG
AGCATGCGCGCTCGTCTCCTGCGCCGCCAGATCGCCAAGAAGACTGCTGAAGCTGCTT
AATAGCGGCTTTGACATCATCTGATATTCAGAAGGCTTGAATGGCTTTTCGCCGCTCA
AgccttttgtTTG

    AGR_L_2416 Gene: AGR_L_2416     GI: 15891321     BI number: AGR_L_2416     GOG: COG1738     Description: AGR_L_2416 AA T  T        A TA       T  T CG       A  T GC        GC TG        TA         T CG        CG       T  T GC        TA       T  C AT       A  A       CG AT        CG        GC GT        TG        GC T  G      |  C       TG C  A      A  T      A  C GC       C  T       AT TA       A  G       GC C  |      G  A       TA AT       T  A       TA GC       T  T       Cg A  A       TG        Gc AT        CG        Gc GC        GC        At AT        GT        At                         ttgtTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1738 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................