                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:64 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -7.80 kcal/mol
Antiterminator: Size=57 nt.     Delta G=-22.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGAAGAGCGCGTCGATGCGGCCGCCGGTCCGGGCTGCAACGGTGTCCACCAGCGCGGC
GATGGTTTCCGGCTTGGTGTAATCCATGATCAGGGTTTCGATGCCCTGATTTTCGAGC
GCGGCCATGTCGACGATGCGGCGCACggtggcaaaaacccgccagccgtcccgctgaagcgcgccggcgcaataggcgccg
atgccagaggaacatccggtgatgatgatgaccggtttttcagacatgttccgctccgccaatggtctttgcgccaagtcgcgcccaggtttacaaaatt
aaaTTG

    AGR_L_2474 Gene: AGR_L_2474     GI: 15891350     BI number: AGR_L_2474     GOG: COG1295     Description: AGR_L_2474   t a  a a  g cg gc cg gc gc cg c  a gt cg gc c  | g  | a  | a  | gc ta cg g  a c  | cg cg ta        at |  a      g  g |  c       ta |  a       at |  t      g  g |  c       ta gc        gc cg        gc cg        cg gt        cg             tttttcagacatgttccgctccgccaatggtctttgcgccaagtcgcgcccaggtttacaaaattaaaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1295 Predicted membrane protein ... can be seen here     ..................................................................................................................