                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:134 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-11.00 kcal/mol
Antiterminator: Size=50 nt.     Delta G=-15.50 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G=-10.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGATACGGCCAAGTAGTTTTCCGCCGTCACCTTGCCGCCGGTGCCGGCAAGGATACGC
GCCCATATGGCATTGGCACTGGCGCGCGATACCATCTGCGACACGACGATATGGGCAA
GGCCTGCAAAGCCGGGCTCATGAATGCGCAATTCCAGCGGGCCTGCTTTTTCGATGAC
GGGGCTGAGCGCAGGATCGAGGCGGGCGAGATGGTCCAGCCCTTCGCTGATGTCATCC
ATCCCGGTGATGATTTTCATatcggtcattccctaggccgccagccggctggcggggcactttaaaacATG

    AGR_L_2475 Gene: AGR_L_2475     GI: 15891351     BI number: AGR_L_2475     GOG: COG0008     Description: AGR_L_2475 AC C  G A  A GC CG G  A T  T        C C  |      G  A TA       T  A AT       C  A CG        CG CG        GC A  |       GC T  |      A  G A  |      A  G G  |       CG C  |       GC         G G  |       GT       C  C C  |       GC       G  A G  |       TA        TA CG        AT        AT GC        TG        AT G  A      A  A       GC TA       G  A      |  C CG       C  |      |  A A  |      A  |      T  G CG       G  |      A  C GC       C  |       CG GC        AT        TG T  |       CG        CG T  |      A  |       GC AT        GC        GC CG        CG        GT GC        GC        CG                         CTTTTTCGATGACGGGGCTGAGCGCAGGATCGAGGCGGGCGAGATGGTCCAGCCCTTCGCTGATGTCATCCATCCCGGTGATGATTTTCATatcggtcattccctaggccgccagccggctggcggggcactttaaaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0008 Glutamyl- and glutaminyl-tRNA synthetases ... can be seen here     ..................................................................................................................