                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:56 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G= -9.90 kcal/mol
Antiterminator: Size=32 nt.     Delta G=-11.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATCACCGACAGGCTGTTTTTCTGGCGCACCAGTTCCGTGCTTGCAATGGCGGACATGG
GCTGGGGCATGCTCCCTGAACGGCCTTTTTTCCTGTCGTGCTTATCCCCTCTGATGGC
GCATGCCACGAGCAAGATCAAGGCACCCGGATGCTGCCCGCAGCCGTTGTTGACAGCA
TGAGGAATCTCTGACATTAATTTTCTCGACTGTCGAGAAAATTGTGAAACCACagagaccg
acagctttttccgggcgttttccctgcatggaggtgcggggcttcgcccctaccgggaggacatcATG

    AGR_L_2505 --- AGR_L_2507 --- AGR_L_2509 Gene: AGR_L_2505     GI: 15891364     BI number: AGR_L_2505     GOG: COG4213     Description: AGR_L_2505p Gene: AGR_L_2507     GI: 15891365     BI number: AGR_L_2507     GOG: COG4214     Description: AGR_L_2507p Gene: AGR_L_2509     GI: 15891366     BI number: AGR_L_2509     GOG: COG1129     Description: AGR_L_2509            AA           A  C   T        GC C  G       TA A  T       GC GC        Ta CG        Tg TA       A  a CG       A  g TA       A  a TA       A  c TA       G  | TA       A  | AT        Gc AT        Cg T  |       Ta TG        Gc AT        Ta CG        Cg             ctttttccgggcgttttccctgcatggaggtgcggggcttcgcccctaccgggaggacatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG4213 ABC-type xylose transport system, periplasmic component ... can be seen here [G] COG4214 ABC-type xylose transport system, permease component ... can be seen here [G] COG1129 ABC-type sugar transport system, ATPase component ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:212 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -9.90 kcal/mol Antiterminator: Size=41 nt.     Delta G=-19.10 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ATCACCGACAGGCTGTTTTTCTGGCGCACCAGTTCCGTGCTTGCAATGGCGGACATGG GCTGGGGCATGCTCCCTGAACGGCCTTTTTTCCTGTCGTGCTTATCCCCTCTGATGGC GCATGCCACGAGCAAGATCAAGGCACCCGGATGCTGCCCGCAGCCGTTGTTGACAGCA TGAGGAATCTCTGACATTAATTTTCTCGACTGTCGAGAAAATTGTGAAACCACagagaccg acagctttttccgggcgttttccctgcatggaggtgcggggcttcgcccctaccgggaggacatcATG     AGR_L_2505 --- AGR_L_2507 --- AGR_L_2509 Gene: AGR_L_2505     GI: 15891364     BI number: AGR_L_2505     GOG: COG4213     Description: AGR_L_2505p Gene: AGR_L_2507     GI: 15891365     BI number: AGR_L_2507     GOG: COG4214     Description: AGR_L_2507p Gene: AGR_L_2509     GI: 15891366     BI number: AGR_L_2509     GOG: COG1129     Description: AGR_L_2509 AT A  G CG GC TG T  G       TG C  A      A  C GC       C  T TA        GC GT        GC CG        GC CG       |  T T  |      |  G TG       |  A GC       |  A AT        GC CG        TG CG        CG A  G       GC CG        GC GC        GT             TTTTTCCTGTCGTGCTTATCCCCTCTGATGGCGCATGCCACGAGCAAGATCAAGGCACCCGGATGCTGCCCGCAGCCGTTGTTGACAGCATGAGGAATCTCTGACATTAATTTTCTCGACTGTCGAGAAAATTGTGAAACCACagagaccgacagctttttccgggcgttttccctgcatggaggtgcggggcttcgcccctaccgggaggacatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG4213 ABC-type xylose transport system, periplasmic component ... can be seen here [G] COG4214 ABC-type xylose transport system, permease component ... can be seen here [G] COG1129 ABC-type sugar transport system, ATPase component ... can be seen here     ..................................................................................................................