                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=2 nt.   Size=25 nt.     Delta G= -7.40 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-11.70 kcal/mol
Anti-antiterminator:   Size=22 nt.     Delta G= -9.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGGTTGCGGCCGAAATTCTCGCAGACGCGGTTGCGAATATATTCGAGCCGAACCGGA
TTGAATTTGTGCAACGGGCGGAACTTGCCTGTCGGGCTCCACCATTCCGCAGCCATCG
CGGAGAAGCGATCCACCTCGCTCTGATCGACGGTCGTCTGTGCGGTCTCGCTCATgggt
ctgctccatattgctcttgcattgaagtcggatgattgatccccgaagtcaagaccggcggtctattccgcaggtaaattgtcggggggcgcattgccgc
agatggaactgacacggcaccttgtTTG

    AGR_L_2640gl Gene: AGR_L_2640gl     GI: 15891431     BI number: AGR_L_2640gl     GOG: COG4991     Description: AGR_L_2640gl             a           t  a           g  a            gt            at            cg           |  t            gc            cg            cg        gg            tg       t  a            tg       a  a ta       |  g       gc c  t      |  g       at t  t      a  c       cg gc       t  g      |  a gc       c  c      |  c cg        ta       |  a gc        gt        gc g  a       gt        cg cg        cg        cg cg        gc        gc at        gc        ta                         ccttgtTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4991 Uncharacterized protein with a bacterial SH3 domain homologue ... can be seen here     ..................................................................................................................