                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:124 nt.     Distance to run of Ts=1 nt.   Size=26 nt.     Delta G= -8.50 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-14.10 kcal/mol
Anti-antiterminator:   Size=73 nt.     Delta G=-25.91 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGTTGCAATGCCGATAAAGGCGACCACGGCAAAGGCCAGAAGCGTCACGTCGATCATA
TTTTCCTCCCCCGAGGTGGCAGACATTGTCGGCGATATCGCCGCAAGCTTCCATGTCC
GCCTCTTGTGAAGCAGGAGAATACAGGCTTTTGCATTGGCGGCAATGCGGGCGATTTT
TCTGAAAGAAGAGTGCCGGAACCGCCGCCCGAAACAACGCCGCGCACGCATTTCGCTG
CCCTTGGCATATCGATTTCGGCGGCGCATgcttgacagctttcgacacctgtgacaacttgtgaatagTTG

    AGR_L_2740 --- AGR_L_2741 --- AGR_L_2743 --- AGR_L_2744 Gene: AGR_L_2740     GI: 15891479     BI number: AGR_L_2740     GOG: COG0601     Description: AGR_L_2740p Gene: AGR_L_2741     GI: 15891480     BI number: AGR_L_2741     GOG: COG1173     Description: AGR_L_2741p Gene: AGR_L_2743     GI: 15891481     BI number: AGR_L_2743     GOG: COG0444     Description: AGR_L_2743p Gene: AGR_L_2744     GI: 15891482     BI number: AGR_L_2744     GOG: COG1124     Description: AGR_L_2744 TA A  T GC CG GC GC CG T  | GC TA |  A |  G |  C |  T |  T |  C |  C TA AT CG        AA AT       G  T GC       A  A A  C      G  C CG       G  A GC       A  G GC        CG T  |       GC GT       |  T GC        AT        CG AT        AT       G  G GT       G  T       GC CG       T  G       TA |  T       GC        TA |  G       TA        AT C  A      T  T       CG C  A      C  T       GC C  G      T  |       TG C  C       CG       T  | TA        CG       T  | CG        GC        TG CG        CG        CG TA        CG        GC                         GATTTTTCTGAAAGAAGAGTGCCGGAACCGCCGCCCGAAACAACGCCGCGCACGCATTTCGCTGCCCTTGGCATATCGATTTCGGCGGCGCATgcttgacagctttcgacacctgtgacaacttgtgaatagTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EP] COG0601 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here [EP] COG1173 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here [EP] COG0444 ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component ... can be seen here [EP] COG1124 ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component ... can be seen here     ..................................................................................................................