Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:115 nt.     Distance to run of Ts=1 nt.   Size=21 nt.     Delta G= -8.80 kcal/mol
Antiterminator: Size=57 nt.     Delta G=-10.50 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-17.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ggggtattttctatagataaagtgtactatttaaggcgccattggagaaattcgtttccgtcatgacctcgcctgagcgcgacgacggaatatcctttcg
agaatttcgggatttctggtcggatcgtcgcccacttgtttgatcgcatcctccattcagctgcacgtcggctgaaagtttttcttctccgaacagcaag
gatttttaactcgcgaccccaaccccggctgttaggttttcggataatcgcaccggccgcaggccggacagcccacgcggaccgaaagaaaagtagaagc
ATG

    AGR_L_2756


Gene: AGR_L_2756     GI: 15891487     BI number: AGR_L_2756     GOG: COG2141     Description: AGR_L_2756


  a
a  t        c
 gt       g  c
 at       c  c
 gc        ta
 cg        gc
t  |      |  t
t  |      c  t
t  |       tg
 cg        at
 cg        gt
 ta        gt
 at        cg
t  |       ta
 at        gt
 at        gc
 gc        tg
 gt       c  c
 cg       t  |
|  g      t  |
|  t       ta
|  c       at         c
|  g       gc       a  g
|  g       gc       c  t
|  a       gt        gc
 at       c  c       tg
 gc       t  c       cg
 cg       t  |       gc
 at        ta        at
 gc        at        cg
 cg        at        ta
 gc        gc        ta
                        agtttttcttctccgaacagcaaggatttttaactcgcgaccccaaccccggctgttaggttttcggataatcgcaccggccgcaggccggacagcccacgcggaccgaaagaaaagtagaagcATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[C] COG2141 Coenzyme F420-dependent N5,N10-methylene tetrahydromethanopterin reductase and related flavin-dependent oxidoreductases ... can be seen here

    ..................................................................................................................