                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:152 nt.     Distance to run of Ts=2 nt.   Size=28 nt.     Delta G=-10.00 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-26.90 kcal/mol
Anti-antiterminator:   Size=75 nt.     Delta G=-29.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cattgtaaccagatcgaaggactgctggccgcctttccggaccttgccgccgggatcgatatccaccgtgtcggttttcagcgcccgcgagaagcggtca
ttgccgtcgcgggcgaggaaaaccagtcgctgccgctgtttgtttttgccggcgatgcgcccgccgatgcggcaagccacggcgacacgcacttcattca
ggacacgaaacgaattttgcaaatcctcgccgaacgccacgggttcccgcagctccattgagctgccgcacctgcgcatcggattttttcggagacagac
ATG

    AGR_L_2772 --- AGR_L_2773 Gene: AGR_L_2772     GI: 15891493     BI number: AGR_L_2772     GOG: COG0747     Description: AGR_L_2772p Gene: AGR_L_2773     GI: 15891494     BI number: AGR_L_2773     GOG: COG2141     Description: AGR_L_2773   a c  c c  c tg at tg at gc cg tg at gt gt gt |  c c  a cg        at gc       c  t c  |       tg cg        gc gc        gc t  |       cg t  |       gt c  |      a  | c  |      a  | a  |      g  | gc       a  |       aa gc        gc       a  a cg        cg        gc |  c       gc        gc cg        cg       |  a ta        cg       |  g tg        cg        at ta        gc        gc c  a       cg        cg cg       g  a       gc gc       a  g      |  t cg        cg       |  g cg        ta        gc gt        ta        gc gc        ta        cg ta        ta        gc                         tgtttgtttttgccggcgatgcgcccgccgatgcggcaagccacggcgacacgcacttcattcaggacacgaaacgaattttgcaaatcctcgccgaacgccacgggttcccgcagctccattgagctgccgcacctgcgcatcggattttttcggagacagacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0747 ABC-type dipeptide transport system, periplasmic component ... can be seen here [C] COG2141 Coenzyme F420-dependent N5,N10-methylene tetrahydromethanopterin reductase and related flavin-dependent oxidoreductases ... can be seen here     ..................................................................................................................